Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04128

HP ID(1) HP04128
Gene ID(2) 23645
Gene Symbol finder PPP1R15A
Protein Name protein phosphatase 1, regulatory (inhibitor) subunit 15A
RefSeq NM_014330.3
Length of RefSeq (bp) 2399
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.631593

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe05D02 pKA1U5 GGCTCTTATCGGTTCCCATCCCAGTTGTTGATCTTATGCAAGACGCTGCACGACCCCGCG
RBd50D09 pGCAP10 GGCTCTTATCGGTTCCCATCCCAGTTGTTGATCTTATGCAAGACGCTGCACGACCCCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl