Prev. |  KEGG KO K14019 > 

RIKEN DNA Bank Human Resource - PPP1R15A

Gene ID NCBI Gene 23645 |  KEGG hsa:23645
Gene Symbol PPP1R15A
Protein Name protein phosphatase 1 regulatory subunit 15A
Synonyms GADD34
Ortholog resource in our bank

  PPP1R15A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07307 pGL4-phPPP1R15A Promoter collection, Human PPP1R15A promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082818 IRAL007A18 pOTB7 BC003067 NM_014330 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042074 ARe05D02 pKA1U5 NM_014330.3  
GGCTCTTATCGGTTCCCATCCCAGTTGTTGATCTTATGCAAGACGCTGCACGACCCCGCG
HKR380081 RBd50D09 pGCAP10 NM_014330.3  
GGCTCTTATCGGTTCCCATCCCAGTTGTTGATCTTATGCAAGACGCTGCACGACCCCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl