Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04117

HP ID(1) HP04117
Gene ID(2) 10078
Gene Symbol finder TSSC4
Protein Name tumor suppressing subtransferable candidate 4
RefSeq NM_005706.2
Length of RefSeq (bp) 1443
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.523424

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48C01 pKA1U5 GGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGAACAG
ARe89C08 pKA1U5 GAGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGA
ARe90A09 pKA1U5 GACGGAGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAG
RBd22C01 pGCAP10 GGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGAACAGAGGCCATGCCGGGGCAC
RBd22C02 pGCAP10
RBd56E05 pGCAP10 GAGGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCNNNNNCCGNTGAGCAGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl