Prev. | 

RIKEN DNA Bank Human Resource - TSSC4

Gene ID NCBI Gene 10078 |  KEGG hsa:10078
Gene Symbol TSSC4
Protein Name tumor suppressing subtransferable candidate 4
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044123 IRAK110F03 pCMV-SPORT6 BC050616 NM_005706 Partial/var
HGY087427 IRAL018J11 pOTB7 BC006091 NM_005706 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059249 ARe48C01 pKA1U5 NM_005706.2  
GGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGAACAG
HKR075656 ARe89C08 pKA1U5 NM_005706.2  
GAGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGA
HKR076009 ARe90A09 pKA1U5 NM_005706.2  
GACGGAGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAG
HKR368849 RBd22C01 pGCAP10 NM_005706.2  
GGGAGACTGCCGAGCAGCCTTGAGCCGTTGAGCAGCTGAACAGAGGCCATGCCGGGGCAC
HKR368850 RBd22C02 pGCAP10 NM_005706.2  
HKR382501 RBd56E05 pGCAP10 NM_005706.2  
GAGGGTGCGGCGCCGACCAAGATGGAGACTGCCGAGCAGCCNNNNNCCGNTGAGCAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl