Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04102

HP ID(1) HP04102
Gene ID(2) 435
Gene Symbol finder ASL
Protein Name argininosuccinate lyase
RefSeq NM_001024943.1
Length of RefSeq (bp) 2061
Chromosome 7cen-q11.2
Reference DDBJ accession
UniGene Hs.632015

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085G09 pGCAP10 GACTATCCGTGCGGCCAGGCGGAGACCCGGAGGACCGAAGCTTCCGGACGACGAGGAACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl