Prev. |  KEGG KO K01755 > 

RIKEN DNA Bank Human Resource - ASL

Gene ID NCBI Gene 435 |  KEGG hsa:435
Gene Symbol ASL
Protein Name argininosuccinate lyase
Synonyms ASAL
Ortholog resource in our bank

  ASL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001239 IRAK003B15 pCMV-SPORT6 BC008195 NM_001024943 Full
HGY097268 IRAL043C20 pOTB7 BC033146 NM_001024943 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091623 M01C029A23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091671 M01C029C23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091719 M01C029E23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091767 M01C029G23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091815 M01C029I23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091863 M01C029K23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091911 M01C029M23 pDONR221 MGC04-A12 BC008195 NM_001024943  
HGE091959 M01C029O23 pDONR221 MGC04-A12 BC008195 NM_001024943  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234153 ARiS085G09 pGCAP10 NM_001024943.1  
GACTATCCGTGCGGCCAGGCGGAGACCCGGAGGACCGAAGCTTCCGGACGACGAGGAACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl