Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04093

HP ID(1) HP04093
Gene ID(2) 22932
Gene Symbol finder POMZP3
Protein Name POM (POM121 homolog, rat) and ZP3 fusion
RefSeq NM_012230.3
Length of RefSeq (bp) 1564
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.488877

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS187H02 pGCAP10 AAGTCTCCTCCGCGGCGCGGAGCCGCGATGTCTCCGGCGGCTGCGGCGGCTGGAGCAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl