Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187H02

Clone ID RBdS187H02
HP ID HP04093
Gene ID 22932
Gene Symbol POMZP3
Protein Name POM (POM121 homolog, rat) and ZP3 fusion
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_012230.3
Length of RefSeq (bp) 1564
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.488877
5'-terminal sequence AAGTCTCCTCCGCGGCGCGGAGCCGCGATGTCTCCGGCGGCTGCGGCGGCTGGAGCAGGC
2011.08.28