Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04078

HP ID(1) HP04078
Gene ID(2) 26073
Gene Symbol finder POLDIP2
Protein Name polymerase (DNA-directed), delta interacting protein 2
RefSeq NM_015584.3
Length of RefSeq (bp) 2723
Chromosome 17q11.2
Reference DDBJ accession
UniGene Hs.241543

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe76E01 pKA1U5 TTGAGCCGGGCGGGCGCTCGGGCGGGACATGGCANNCTGTACAGCCCGGCGGGCCCTGGC
ARi60G04 pGCAP10 GAGCCGGGCGGGCGCTCGGGCGGGACATGGCACCCTGTACAGCCCGGCGGGCCCTGGCCG
RBdS070G02 pGCAP10 GAGTGTGGGACTGGGGCGGAACGCCGCCCGGCCGCGGGTCGGGCTCTGTGTCAGCAGCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl