Prev. |  KEGG KO K17809 > 

RIKEN DNA Bank Human Resource - POLDIP2

Gene ID NCBI Gene 26073 |  KEGG hsa:26073
Gene Symbol POLDIP2
Protein Name DNA polymerase delta interacting protein 2
Synonyms PDIP38|POLD4|p38
Ortholog resources KEGG ortholog (KEGG orthology K17809) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082042 IRAL005B18 pOTB7 BC000655 NM_015584 Full
HGY090157 IRAL025G13 pOTB7 BC009265 NM_015584 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070497 ARe76E01 pKA1U5 NM_015584.3  
TTGAGCCGGGCGGGCGCTCGGGCGGGACATGGCANNCTGTACAGCCCGGCGGGCCCTGGC
HKR184148 ARi60G04 pGCAP10 NM_015584.3  
GAGCCGGGCGGGCGCTCGGGCGGGACATGGCACCCTGTACAGCCCGGCGGGCCCTGGCCG
HKR428146 RBdS070G02 pGCAP10 NM_015584.3  
GAGTGTGGGACTGGGGCGGAACGCCGCCCGGCCGCGGGTCGGGCTCTGTGTCAGCAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl