Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04072

HP ID(1) HP04072
Gene ID(2) 10758
Gene Symbol finder TRAF3IP2
Protein Name TRAF3 interacting protein 2
RefSeq NM_147200.1
Length of RefSeq (bp) 2366
Chromosome 6q21
Reference DDBJ accession
UniGene Hs.654708

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe82B04 pKA1U5 GGGGCCCGGAGAAGGTGGAGGGAGACGAGAAGCCGCCGAGAGCCGACTACCCTCCGGGCC
ARi51E06 pGCAP10 GAGAGGCTTCCTAGGCTCCGTAGAAATTTGCATACAGCTTCCACTTCCTGCTTCAGAGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl