Prev. |  KEGG KO K21124 > 

RIKEN DNA Bank Human Resource - TRAF3IP2

Gene ID NCBI Gene 10758 |  KEGG hsa:10758
Gene Symbol TRAF3IP2
Protein Name TRAF3 interacting protein 2
Synonyms ACT1|C6orf2|C6orf4|C6orf5|C6orf6|CANDF8|CIKS|PSORS13
Ortholog resource in our bank

  TRAF3IP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084972 IRAL012H04 pOTB7 BC002823 NM_147686 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025466 W01A063L02 pENTR-TOPO IRAL012H04 BC002823 NM_147686  
HGE025472 W01A063L08 pENTR-TOPO IRAL012H04 BC002823 NM_147686  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072828 ARe82B04 pKA1U5 NM_147200.1  
GGGGCCCGGAGAAGGTGGAGGGAGACGAGAAGCCGCCGAGAGCCGACTACCCTCCGGGCC
HKR180502 ARi51E06 pGCAP10 NM_147200.1  
GAGAGGCTTCCTAGGCTCCGTAGAAATTTGCATACAGCTTCCACTTCCTGCTTCAGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl