Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04063

HP ID(1) HP04063
Gene ID(2) 90417
Gene Symbol finder C15orf23
Protein Name chromosome 15 open reading frame 23
RefSeq NM_033286.3
Length of RefSeq (bp) 1763
Chromosome 15q15.1
Reference DDBJ accession
UniGene Hs.525796

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb12B03 pKA1U5 GAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCTGGGG
RBd21H09 pGCAP10 TGAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl