Prev. | 

RIKEN DNA Bank Human Resource - KNSTRN

Gene ID NCBI Gene 90417 |  KEGG hsa:90417
Gene Symbol KNSTRN
Protein Name kinetochore localized astrin (SPAG5) binding protein
Synonyms C15orf23|HSD11|SKAP|TRAF4AF1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19644 pcDNA/TO/myc-kinastrin_wt Expression vector of human KNSTRN, Tet inducible.
RDB19645 pcDNA/TO/myc-kinastrin_Y87F Expression vector of human KNSTRN phosphodead mutant (Y87F), Tet inducible.
RDB19646 pcDNA/TO/myc-kinastrin_Y87E Expression vector of human KNSTRN phosphomimetic (Y87E), Tet inducible.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036283 IRAK090L19 pBluescript BC045739 NM_033286 Partial/var
HGX053800 IRAK134I08 pCMV-SPORT6 BC064344 NM_033286 Partial
HGY086237 IRAL015J21 pOTB7 BC004543 NM_033286 Partial/var
HGY091328 IRAL028F08 pOTB7 BC014060 NM_033286 Partial/var
HGY096032 IRAL040B08 pOTB7 BC021124 NM_033286 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324827 RBb12B03 pKA1U5 NM_033286.3  
GAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCTGGGG
HKR368577 RBd21H09 pGCAP10 NM_033286.3  
TGAGGGAATCTTTTAAACGAGAGCGAGAAGGACTGCGGGCAGGACCGGCGGGCTCCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.02

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl