Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04023

HP ID(1) HP04023
Gene ID(2) 23481
Gene Symbol finder PES1
Protein Name pescadillo homolog 1, containing BRCT domain (zebrafish)
RefSeq NM_014303.2
Length of RefSeq (bp) 2279
Chromosome 22q12.1
Reference DDBJ accession
UniGene Hs.517543

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb27F11 pGCAP1 GCTCCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGAGA
RBb30E11 pGCAP1 TGGACGTGCGGGAGGAAGTGGAGCTCCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGT
RBd48E04 pGCAP10 GAGCTGCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGA
RBdS154D15 pGCAP10 GAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGAGAAGAAGAAGTATGAACGAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl