Prev. |  KEGG KO K14843 > 

RIKEN DNA Bank Human Resource - PES1

Gene ID NCBI Gene 23481 |  KEGG hsa:23481
Gene Symbol PES1
Protein Name pescadillo ribosomal biogenesis factor 1
Synonyms NOP7|PES
Ortholog resource in our bank

  PES1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025964 IRAK064P04 pCMV-SPORT6 BC032489 NM_014303 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037922 W01A094N10 pENTR-TOPO IRAK064P04 BC032489 NM_014303  
HGE037926 W01A094N14 pENTR-TOPO IRAK064P04 BC032489 NM_014303  
HGE037930 W01A094N18 pENTR-TOPO IRAK064P04 BC032489 NM_014303  
HGE037970 W01A094P10 pENTR-TOPO IRAK064P04 BC032489 NM_014303  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330931 RBb27F11 pGCAP1 NM_014303.2  
GCTCCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGAGA
HKR332107 RBb30E11 pGCAP1 NM_014303.2  
TGGACGTGCGGGAGGAAGTGGAGCTCCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGT
HKR379300 RBd48E04 pGCAP10 NM_014303.2  
GAGCTGCCTGTACGCGCGGCCCTAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGA
HKR461687 RBdS154D15 pGCAP10 NM_014303.2  
GAGTCGGCTCCTCAACGTGGAGCGATGGGAGGCCTTGAGAAGAAGAAGTATGAACGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl