Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04017

HP ID(1) HP04017
Gene ID(2) 7283
Gene Symbol finder TUBG1
Protein Name tubulin, gamma 1
RefSeq NM_001070.3
Length of RefSeq (bp) 1645
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.279669

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd07A01 pGCAP10 GGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCGGTGCCTGAGGAGCGATGCCGA
RBd17D04 pGCAP10
RBd17G01 pGCAP10 GAGCGGCTGCAACGCCGGTGCCTGAGGAGCGATGCCGAGGGAAATCATCACCCTACAGTT
RBd78D08 pGCAP10 GGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCNGTGCCTGAGGAGCGATGCCGAGG
RBd95F11 pGCAP10 GGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCGGTGCCTGAGGAGC
RBdS154A16 pGCAP10 GGCGTCTTGCGGCGAGCGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACG
RBdS156K14 pGCAP10 GGGTTTGGCGCCTGCGTCTTGCGGCGAGCGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl