Prev. |  KEGG KO K10389 > 

RIKEN DNA Bank Human Resource - TUBG1

Gene ID NCBI Gene 7283 |  KEGG hsa:7283
Gene Symbol TUBG1
Protein Name tubulin gamma 1
Synonyms CDCBM4|GCP-1|TUBG|TUBGCP1
Ortholog resource in our bank

  TUBG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082290 IRAL005M02 pOTB7 BC000619 NM_001070

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007071 W01A017L07 pENTR-TOPO IRAL005M02 BC000619 NM_001070  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR362801 RBd07A01 pGCAP10 NM_001070.3  
GGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCGGTGCCTGAGGAGCGATGCCGA
HKR366945 RBd17G01 pGCAP10 NM_001070.3  
GAGCGGCTGCAACGCCGGTGCCTGAGGAGCGATGCCGAGGGAAATCATCACCCTACAGTT
HKR391280 RBd78D08 pGCAP10 NM_001070.3  
GGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCNGTGCCTGAGGAGCGATGCCGAGG
HKR398131 RBd95F11 pGCAP10 NM_001070.3  
GGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACGCCGGTGCCTGAGGAGC
HKR461616 RBdS154A16 pGCAP10 NM_001070.3  
GGCGTCTTGCGGCGAGCGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGAGCGGCTGCAACG
HKR462654 RBdS156K14 pGCAP10 NM_001070.3  
GGGTTTGGCGCCTGCGTCTTGCGGCGAGCGGGCTGGCGTGCGGCGCCGTTGCGGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl