Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04016

HP ID(1) HP04016
Gene ID(2) 5162
Gene Symbol finder PDHB
Protein Name pyruvate dehydrogenase (lipoamide) beta
RefSeq NM_000925.2
Length of RefSeq (bp) 1516
Chromosome 3p21.1-p14.2
Reference DDBJ accession
UniGene Hs.161357

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi46H02 pGCAP10 GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
ARi71E04 pGCAP10 GCCCTCTGTTGTCGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGG
ARiS088D18 pGCAP10 GGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAG
ARiS122H14 pGCAP10 CGGCCGGCCGATGGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
ARiS150A07 pGCAP10 TGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
RBb40F04 pGCAP1 TGGTTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
RBd55E02 pGCAP10 GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
RBd58D09 pGCAP10 GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
RBdS105G06 pGCAP10 GACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl