Prev. |  KEGG KO K00162 > 

RIKEN DNA Bank Human Resource - PDHB

Gene ID NCBI Gene 5162 |  KEGG hsa:5162
Gene Symbol PDHB
Protein Name pyruvate dehydrogenase E1 beta subunit
Synonyms PDHBD|PDHE1-B|PDHE1B|PHE1B
Ortholog resources KEGG ortholog (KEGG orthology K00162) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080479 IRAL001D07 pOTB7 BC000439 NM_000925 Full/var
HGY083665 IRAL009C17 pOTB7 BC001924 NM_000925 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178570 ARi46H02 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR188500 ARi71E04 pGCAP10 NM_000925.2  
GCCCTCTGTTGTCGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGG
HKR235290 ARiS088D18 pGCAP10 NM_000925.2  
GGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAG
HKR248982 ARiS122H14 pGCAP10 NM_000925.2  
CGGCCGGCCGATGGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
HKR260007 ARiS150A07 pGCAP10 NM_000925.2  
TGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR336124 RBb40F04 pGCAP1 NM_000925.2  
TGGTTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
HKR382098 RBd55E02 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR383281 RBd58D09 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR442150 RBdS105G06 pGCAP10 NM_000925.2  
GACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl