Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PDHB

Gene ID (NCBI) 5162
Gene Symbol PDHB
Protein Name pyruvate dehydrogenase (lipoamide) beta
Synonyms PDHBD|PDHE1-B|PHE1B
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080479 IRAL001D07 pOTB7 BC000439 NM_000925 Full/var
HGY083665 IRAL009C17 pOTB7 BC001924 NM_000925 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178570 ARi46H02 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR188500 ARi71E04 pGCAP10 NM_000925.2  
GCCCTCTGTTGTCGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGG
HKR235290 ARiS088D18 pGCAP10 NM_000925.2  
GGTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAG
HKR248982 ARiS122H14 pGCAP10 NM_000925.2  
CGGCCGGCCGATGGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
HKR260007 ARiS150A07 pGCAP10 NM_000925.2  
TGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR336124 RBb40F04 pGCAP1 NM_000925.2  
TGGTTTTGGCAGCGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGG
HKR382098 RBd55E02 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR383281 RBd58D09 pGCAP10 NM_000925.2  
GGGATAGAGGACACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGG
HKR442150 RBdS105G06 pGCAP10 NM_000925.2  
GACGACCAAGATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl