Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03942

HP ID(1) HP03942
Gene ID(2) 7485
Gene Symbol finder WRB
Protein Name tryptophan rich basic protein
RefSeq NM_004627.3
Length of RefSeq (bp) 1573
Chromosome 21q22.3
Reference DDBJ accession
UniGene Hs.198308

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS055J01 pGCAP10 GGCGGCTTCCAAGCTCTAAATGGAGAGTTGTCCCTACTGTGCGGCAGGCGGAGGAGACCT
RBd06B02 pGCAP10 GAGGCGCGGTCGCCGCTGTTGTTGTGGTCCCCATGGAGCTGCCGTAGCGGACCCAGCACA
RBdS007I02 pGCAP10 GGACACCCTCAGGCGACTGGCGGGTCGCGGCTTCCAAGCTCTAAATGGAGAGTTGTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl