Prev. |  KEGG KO K22384 > 

RIKEN DNA Bank Human Resource - GET1

Gene ID NCBI Gene 7485 |  KEGG hsa:7485
Gene Symbol GET1
Protein Name guided entry of tail-anchored proteins factor 1
Synonyms CHD5|WRB
Ortholog resource in our bank

  GET1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008645 IRAK021K05 pCMV-SPORT6 BC012415 NM_004627 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045357 W01A113G13 pENTR-TOPO IRAK021K05 BC012415 NM_004627  
HGE045359 W01A113G15 pENTR-TOPO IRAK021K05 BC012415 NM_004627  
HGE045363 W01A113G19 pENTR-TOPO IRAK021K05 BC012415 NM_004627  
HGE045367 W01A113G23 pENTR-TOPO IRAK021K05 BC012415 NM_004627  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222217 ARiS055J01 pGCAP10 NM_004627.3  
GGCGGCTTCCAAGCTCTAAATGGAGAGTTGTCCCTACTGTGCGGCAGGCGGAGGAGACCT
HKR362426 RBd06B02 pGCAP10 NM_004627.3  
GAGGCGCGGTCGCCGCTGTTGTTGTGGTCCCCATGGAGCTGCCGTAGCGGACCCAGCACA
HKR402994 RBdS007I02 pGCAP10 NM_004627.3  
GGACACCCTCAGGCGACTGGCGGGTCGCGGCTTCCAAGCTCTAAATGGAGAGTTGTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl