Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03877

HP ID(1) HP03877
Gene ID(2) 81671
Gene Symbol finder TMEM49
Protein Name transmembrane protein 49
RefSeq NM_030938.3
Length of RefSeq (bp) 2197
Chromosome 17q23.1
Reference DDBJ accession
UniGene Hs.444569

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi39D12 pGCAP10 GGGGTTCCGGTTGTCTGGAGCCCAGCGGCGGGTGTGAGAGTCCGTAAGGAGCAGCTTCCA
ARiS087J08 pGCAP10 GAGTTCTTACAGGAACTAGTGGTGATAAATGTGGGACTTCTGAGAAGTCATTCATTTTAT
RBdS105L14 pGCAP10 GAGAGTCCGTAAGGAGCAGCTTCCAGGATCCTGAGATCCGGAGCAGCCGGGGTCGGAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl