Prev. |  KEGG KO K21248 > 

RIKEN DNA Bank Human Resource - VMP1

Gene ID NCBI Gene 81671 |  KEGG hsa:81671
Gene Symbol VMP1
Protein Name vacuole membrane protein 1
Synonyms EPG3|TANGO5|TMEM49
Featured content Autophagy (human)
Ortholog resource in our bank

  VMP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085632 IRAL014B08 pOTB7 BC009758 NM_030938 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175684 ARi39D12 pGCAP10 NM_030938.3  
GGGGTTCCGGTTGTCTGGAGCCCAGCGGCGGGTGTGAGAGTCCGTAAGGAGCAGCTTCCA
HKR235024 ARiS087J08 pGCAP10 NM_030938.3  
GAGTTCTTACAGGAACTAGTGGTGATAAATGTGGGACTTCTGAGAAGTCATTCATTTTAT
HKR442278 RBdS105L14 pGCAP10 NM_030938.3  
GAGAGTCCGTAAGGAGCAGCTTCCAGGATCCTGAGATCCGGAGCAGCCGGGGTCGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl