Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03864

HP ID(1) HP03864
Gene ID(2) 23039
Gene Symbol finder XPO7
Protein Name exportin 7
RefSeq NM_015024.4
Length of RefSeq (bp) 4880
Chromosome 8p21
Reference DDBJ accession
UniGene Hs.172685

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARf07F08 pKA1U5 AAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGCTGTA
RBd62H12 pGCAP10 GGGGGGGGCCGGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl