Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03860

HP ID(1) HP03860
Gene ID(2) 200845
Gene Symbol finder KCTD6
Protein Name potassium channel tetramerisation domain containing 6
RefSeq NM_153331.3
Length of RefSeq (bp) 1840
Chromosome 3p14.3
Reference DDBJ accession
UniGene Hs.13982

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh05E01 pGCAP1 TTTTGGCTCTCCGGCCGCGGGCATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCG
RBd06D07 pGCAP10 TGCTCTCCGGCCGCGGGCATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCGCCGCGCATTT
RBd23D12 pGCAP10 GATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCGCCGCGCATTTCCCTGAAACCTGGGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl