Prev. | 

RIKEN DNA Bank Human Resource - KCTD6

Gene ID NCBI Gene 200845 |  KEGG hsa:200845
Gene Symbol KCTD6
Protein Name potassium channel tetramerization domain containing 6
Synonyms KCASH3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR122097 ARh05E01 pGCAP1 NM_153331.3  
TTTTGGCTCTCCGGCCGCGGGCATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCG
HKR362479 RBd06D07 pGCAP10 NM_153331.3  
TGCTCTCCGGCCGCGGGCATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCGCCGCGCATTT
HKR369284 RBd23D12 pGCAP10 NM_153331.3 done
GATCTCCCGGCCCGGCCGCAGCAGCCGCCGCCGCCGCGCATTTCCCTGAAACCTGGGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl