Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03850

HP ID(1) HP03850
Gene ID(2) 10298
Gene Symbol finder PAK4
Protein Name p21(CDKN1A)-activated kinase 4
RefSeq NM_001014831.2
Length of RefSeq (bp) 3064
Chromosome 19q13.2
Reference DDBJ accession
UniGene Hs.20447

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi32D03 pGCAP10 GGATTCAACATGGCGGCGGGAGTGTCCGCGGTGGTGGCGGTGCAAGAGAGCTGAGGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl