Prev. |  KEGG KO K05734 > 

RIKEN DNA Bank Human Resource - PAK4

Gene ID NCBI Gene 10298 |  KEGG hsa:10298
Gene Symbol PAK4
Protein Name p21 (RAC1) activated kinase 4
Synonyms -
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Featured content Axon guidance - human
Ortholog resource in our bank

  PAK4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005349 IRAK013G05 pCMV-SPORT6 BC011368 NM_005884 Full
HGX008773 IRAK021P13 pCMV-SPORT6 BC034511 NM_005884 Full/var
HGY086118 IRAL015E22 pOTB7 BC002921 NM_001014833 Full/var
HGY097122 IRAL042N10 pOTB7 BC025282 NM_005884 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172875 ARi32D03 pGCAP10 NM_001014831.2  
GGATTCAACATGGCGGCGGGAGTGTCCGCGGTGGTGGCGGTGCAAGAGAGCTGAGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl