Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03836

HP ID(1) HP03836
Gene ID(2) 10190
Gene Symbol finder TXNDC9
Protein Name thioredoxin domain containing 9
RefSeq NM_005783.3
Length of RefSeq (bp) 1556
Chromosome 2q11.2
Reference DDBJ accession
UniGene Hs.536122

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109K05 pGCAP10 GAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGTGTCTTTTGAAACTGCTG
ARiS194B14 pGCAP10 GGCAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGTGTCTTTTGAAACTGC
RBb28H10 pGCAP1 GGTGACGGCCCGNTTTGCAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl