Prev. | 

RIKEN DNA Bank Human Resource - TXNDC9

Gene ID NCBI Gene 10190 |  KEGG hsa:10190
Gene Symbol TXNDC9
Protein Name thioredoxin domain containing 9
Synonyms APACD|PHLP3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088607 IRAL021I15 pDNR-LIB BC005968 NM_005783 Full
HGY092857 IRAL032C09 pDNR-LIB BC024223 NM_005783 Partial/var
HGY092951 IRAL032G07 pDNR-LIB BC022864 NM_005783 Full
HGY102860 IRAL057C12 pDNR-LIB BC070183 NM_005783 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243845 ARiS109K05 pGCAP10 NM_005783.3  
GAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGTGTCTTTTGAAACTGCTG
HKR277638 ARiS194B14 pGCAP10 NM_005783.3  
GGCAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGTGTCTTTTGAAACTGC
HKR331378 RBb28H10 pGCAP1 NM_005783.3  
GGTGACGGCCCGNTTTGCAGCCGCCGGCAGCTACTGCAAGGCAAAAGCCGGAGTGGACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl