Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03790

HP ID(1) HP03790
Gene ID(2) 55544
Gene Symbol finder RBM38
Protein Name RNA binding motif protein 38
RefSeq NM_017495.4
Length of RefSeq (bp) 2401
Chromosome 20q13.31
Reference DDBJ accession
UniGene Hs.236361

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd33F12 pGCAP10 GGGTCGGGAGCGCAGCGCGGCGCAGCTCGGCGCGCACGGCGGGAGCGGCGCGCGAGTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl