Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03771

HP ID(1) HP03771
Gene ID(2) 10295
Gene Symbol finder BCKDK
Protein Name branched chain ketoacid dehydrogenase kinase
RefSeq NM_005881.2
Length of RefSeq (bp) 2097
Chromosome 16p11.2
Reference DDBJ accession
UniGene Hs.513520

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34F03 pKA1U5 GGGCCCACGCGACGTCACGGCGGCGGAGGGCGCAGGCGGCTGGGCGCCTGGCGAGTGGAC
ARe58A07 pKA1U5 GACGCGACGTCACGGCGGCGGAGGGCGCAGGCGGCTGGGCGCCTGGCGAGTGGACTGTTC
ARiS161P08 pGCAP10 GGGNGNNGCNGAGGGCGCANGCGGCTGGGCGCCTGGCGAGTGGACTGTTCGAGCCCTTCC
RBdS110D20 pGCAP10 GGCTGGGACCCGGGCCCTGGCTCCGGCCCCGCGATGGGAGCTGCTCTCCGCGGGCTGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl