Prev. |  KEGG KO K00905 > 

RIKEN DNA Bank Human Resource - BCKDK

Gene ID NCBI Gene 10295 |  KEGG hsa:10295
Gene Symbol BCKDK
Protein Name branched chain ketoacid dehydrogenase kinase
Synonyms BCKDKD|BDK
Ortholog resources KEGG ortholog (KEGG orthology K00905) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY089629 IRAL024B05 pOTB7 BC007363 NM_005881 Full/var
HGY090167 IRAL025G23 pOTB7 BC009872 NM_005881 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006438 W01A016B14 pENTR-TOPO IRAL024B05 BC007363 NM_005881  
HGE006440 W01A016B16 pENTR-TOPO IRAL024B05 BC007363 NM_005881  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053723 ARe34F03 pKA1U5 NM_005881.2  
GGGCCCACGCGACGTCACGGCGGCGGAGGGCGCAGGCGGCTGGGCGCCTGGCGAGTGGAC
HKR063207 ARe58A07 pKA1U5 NM_005881.2  
GACGCGACGTCACGGCGGCGGAGGGCGCAGGCGGCTGGGCGCCTGGCGAGTGGACTGTTC
HKR264768 ARiS161P08 pGCAP10 NM_005881.2  
GGGNGNNGCNGAGGGCGCANGCGGCTGGGCGCCTGGCGAGTGGACTGTTCGAGCCCTTCC
HKR444092 RBdS110D20 pGCAP10 NM_005881.2  
GGCTGGGACCCGGGCCCTGGCTCCGGCCCCGCGATGGGAGCTGCTCTCCGCGGGCTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl