Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03736

HP ID(1) HP03736
Gene ID(2) 64769
Gene Symbol finder C1orf149
Protein Name chromosome 1 open reading frame 149
RefSeq NM_022756.4
Length of RefSeq (bp) 2166
Chromosome 1p35.3-p33
Reference DDBJ accession
UniGene Hs.17118

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb36G02 pGCAP1 GCGCGCCGCCGCCGCCCGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCG
RBdS040E21 pGCAP10 TGNNCCNGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCGCAGATCCCGG
RBdS081C02 pGCAP10 GGCGCCGCCGCCGCCCGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl