Prev. |  KEGG KO K11344 > 

RIKEN DNA Bank Human Resource - MEAF6

Gene ID NCBI Gene 64769 |  KEGG hsa:64769
Gene Symbol MEAF6
Protein Name MYST/Esa1 associated factor 6
Synonyms C1orf149|CENP-28|EAF6|NY-SAR-91
Ortholog resource in our bank

  MEAF6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030620 IRAK076J04 pBluescriptR BC043239 NM_022756 Partial/var
HGX047959 IRAK119O23 pCMV-SPORT6 BC056406 NM_022756 Full/var
HGY092899 IRAL032E03 pDNR-LIB BC016328 NM_022756 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334546 RBb36G02 pGCAP1 NM_022756.4  
GCGCGCCGCCGCCGCCCGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCG
HKR416117 RBdS040E21 pGCAP10 NM_022756.4  
TGNNCCNGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCGCAGATCCCGG
HKR432450 RBdS081C02 pGCAP10 NM_022756.4  
GGCGCCGCCGCCGCCCGCCTCAGCCCAACATGGCGATGCACAACAAGGCGGCGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl