Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03694

HP ID(1) HP03694
Gene ID(2) 415116
Gene Symbol finder PIM3
Protein Name pim-3 oncogene
RefSeq NM_001001852.2
Length of RefSeq (bp) 2392
Chromosome 22q13
Reference DDBJ accession
UniGene Hs.530381

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS104M22 pGCAP10 GGGGTGAGGCGCTCCGCCTGCTGCGCGTCTACGCGGTCCCCGCGGGCCTTCCGGGCCCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl