Prev. |  KEGG KO K08807 > 

RIKEN DNA Bank Human Resource - PIM3

Gene ID NCBI Gene 415116 |  KEGG hsa:415116
Gene Symbol PIM3
Protein Name Pim-3 proto-oncogene, serine/threonine kinase
Synonyms pim-3
Ortholog resource in our bank

  PIM3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008256 IRAK020K16 pCMV-SPORT6 BC017083 NM_001001852 Partial
HGX056507 IRAK141E11 pCMV-SPORT6 BC064477 NM_001001852 Partial
HGY098891 IRAL047D19 pOTB7 BC052239 NM_001001852 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR441910 RBdS104M22 pGCAP10 NM_001001852.2  
GGGGTGAGGCGCTCCGCCTGCTGCGCGTCTACGCGGTCCCCGCGGGCCTTCCGGGCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl