Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03667

HP ID(1) HP03667
Gene ID(2) 5445
Gene Symbol finder PON2
Protein Name paraoxonase 2
RefSeq NM_000305.2
Length of RefSeq (bp) 1669
Chromosome 7q21.3
Reference DDBJ accession
UniGene Hs.719159

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa47F12 pKA1U5 GGCCGGCACCATCGAAGCCGGGAAGATGGCACCGCCCACGGTAGCTGCTGGCCAGGCCGG
RBd89G11 pGCAP10 GAGGCCGGAGCGAGGCAGCGCGCCCGGCTCCCGCGCCATGGGGCGGCTGGTGGCTGTGGG
RBdS081F18 pGCAP10 GAGGCCGGAGCGAGGCAGCGCGCCCGGCTCCCGCGCCATGGGGCGGCTGGTGGCTGTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl