Prev. |  KEGG KO K01045 > 

RIKEN DNA Bank Human Resource - PON2

Gene ID NCBI Gene 5445 |  KEGG hsa:5445
Gene Symbol PON2
Protein Name paraoxonase 2
Synonyms -
Ortholog resource in our bank

  PON2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005920 IRAK014N08 pCMV-SPORT6 BC009728 NM_001018161
HGX042914 IRAK107E18 pCMV-SPORT6 BC046160 NM_001018161 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR018932 ARa47F12 pKA1U5 NM_000305.2  
GGCCGGCACCATCGAAGCCGGGAAGATGGCACCGCCCACGGTAGCTGCTGGCCAGGCCGG
HKR395755 RBd89G11 pGCAP10 NM_000305.2  
GAGGCCGGAGCGAGGCAGCGCGCCCGGCTCCCGCGCCATGGGGCGGCTGGTGGCTGTGGG
HKR432538 RBdS081F18 pGCAP10 NM_000305.2  
GAGGCCGGAGCGAGGCAGCGCGCCCGGCTCCCGCGCCATGGGGCGGCTGGTGGCTGTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl