Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03651

HP ID(1) HP03651
Gene ID(2) 9341
Gene Symbol finder VAMP3
Protein Name vesicle-associated membrane protein 3 (cellubrevin)
RefSeq NM_004781.3
Length of RefSeq (bp) 2225
Chromosome 1p36.23
Reference DDBJ accession
UniGene Hs.66708

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13E08 pKA1U5 GGTCCCACCCATCTCCCTGGCCTCCGGTCCCAACTTCGCTTCTCTGCTGACCCTCTCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl