Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03629

HP ID(1) HP03629
Gene ID(2) 8611
Gene Symbol finder PPAP2A
Protein Name phosphatidic acid phosphatase type 2A
RefSeq NM_003711.2
Length of RefSeq (bp) 1638
Chromosome 5q11
Reference DDBJ accession
UniGene Hs.696231

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS008O20 pGCAP10 GGCCCGCGAACCCGCGCGCTGCCCGGTCCTGCGCTGCTCAGCGGGAGGGGCTGGACCCCG
RBd51H02 pGCAP10 GGTGGGAGAGAGCGCCGGGATCCGGACGGGGAGCAACCGGGGCAGGCCGTGCCGGCTGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl