DNA Bank Top |  KEGG KO K01080 > 

RIKEN DNA Bank Human Resource - PLPP1

Gene ID NCBI Gene 8611 |  KEGG hsa:8611
Gene Symbol PLPP1
Protein Name phospholipid phosphatase 1
Synonyms LLP1a|LPP1|PAP-2a|PAP2|PPAP2A

Link

Ortholog resource in our bank

  PLPP1


External database

human PLPP1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07792 pGEMHuPAP2aV1 Plasmid clone of human PAP2a variant1 cDNA.    
RDB07791 pGEMHuPAP2aV2    
RDB07759 pRx-bsr-hPAP2a(v1) Retroviral vector of human PAP2a variant1 cDNA.    
RDB07736 pGEM-T Easy-PAP2a(v1) Plasmid clone of human PAP2a variant1 cDNA.    
RDB07735 pQE30-PAP2a (v1) Plasmid clone of human PAP2a variant1 cDNA.    
RDB07598 pCAHuPAP2aV2    
RDB07597 pCAHuPaP2aV1 Expression vector of human PAP2a variant1 cDNA.    
RDB05741 pGEMTeasy hPAP2a V2 Plasmid clone of human PAP2a variant2 cDNA    
RDB05740 pGEMTeasy hPAP2a V1 Plasmid clone of human PAP2a variant1 cDNA    
RDB05739 pCA hPAP2a V2 Expression vector of human PAP2a V2 (variant2) driven by CA promoter    
RDB05738 pCA hPAP2a V1 Expression vector of human PAP2AV1 driven by CA promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033894 IRAK084M06 pCMV-SPORT6 BC039847 NM_003711 Full
HGY085060 IRAL012K20 pOTB7 BC008787 NM_176895

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010131 W01A025F11 pENTR-TOPO IRAK084M06 BC039847 NM_003711  
HGE010135 W01A025F15 pENTR-TOPO IRAK084M06 BC039847 NM_003711  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203556 ARiS008O20 pGCAP10 NM_003711.2  
GGCCCGCGAACCCGCGCGCTGCCCGGTCCTGCGCTGCTCAGCGGGAGGGGCTGGACCCCG
HKR380570 RBd51H02 pGCAP10 NM_003711.2  
GGTGGGAGAGAGCGCCGGGATCCGGACGGGGAGCAACCGGGGCAGGCCGTGCCGGCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl