Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03623

HP ID(1) HP03623
Gene ID(2) 10015
Gene Symbol finder PDCD6IP
Protein Name programmed cell death 6 interacting protein
RefSeq NM_013374.4
Length of RefSeq (bp) 5957
Chromosome 3p22.3
Reference DDBJ accession
UniGene Hs.475896

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe47A09 pKA1U5 GGTCAGCCAGNTCAGTCCGCCAGTCCGCCAGCCCAGNTACCTCTCTCTCCTCGGCCCTCG
ARe83C06 pKA1U5 GCCGGAACGCAGGCGGAGCGCAAGTCTGTCAGCCAGTCAGTCCGCCAGTCCGCCAGCCCA
ARi26F03 pGCAP10 GAGTCAGTCCGCCAGTCCGCCAGCCCAGTACCTCTCTCTCCTCGGCCCTCGTAAGCTGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl