Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PDCD6IP

Gene ID (NCBI) 10015
Gene Symbol PDCD6IP
Protein Name programmed cell death 6 interacting protein
Synonyms AIP1|ALIX|DRIP4|HP95
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX010613 IRAK026I21 pCMV-SPORT6 BC020066 NM_013374 Full
HGY066976 IRAK167H08 pBluescriptR BC068454 NM_013374 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170523 ARi26F03 pGCAP10 NM_013374.4  
GAGTCAGTCCGCCAGTCCGCCAGCCCAGTACCTCTCTCTCCTCGGCCCTCGTAAGCTGTC
HKR058809 ARe47A09 pKA1U5 NM_013374.4  
GGTCAGCCAGNTCAGTCCGCCAGTCCGCCAGCCCAGNTACCTCTCTCTCCTCGGCCCTCG
HKR073254 ARe83C06 pKA1U5 NM_013374.4  
GCCGGAACGCAGGCGGAGCGCAAGTCTGTCAGCCAGTCAGTCCGCCAGTCCGCCAGCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl