Prev. |  KEGG KO K12200 > 

RIKEN DNA Bank Human Resource - PDCD6IP

Gene ID NCBI Gene 10015 |  KEGG hsa:10015
Gene Symbol PDCD6IP
Protein Name programmed cell death 6 interacting protein
Synonyms AIP1|ALIX|DRIP4|HP95
Featured content Endocytosis (human)
Ortholog resource in our bank

  PDCD6IP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010613 IRAK026I21 pCMV-SPORT6 BC020066 NM_013374 Full
HGY066976 IRAK167H08 pBluescriptR BC068454 NM_013374 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058809 ARe47A09 pKA1U5 NM_013374.4  
GGTCAGCCAGNTCAGTCCGCCAGTCCGCCAGCCCAGNTACCTCTCTCTCCTCGGCCCTCG
HKR073254 ARe83C06 pKA1U5 NM_013374.4  
GCCGGAACGCAGGCGGAGCGCAAGTCTGTCAGCCAGTCAGTCCGCCAGTCCGCCAGCCCA
HKR170523 ARi26F03 pGCAP10 NM_013374.4  
GAGTCAGTCCGCCAGTCCGCCAGCCCAGTACCTCTCTCTCCTCGGCCCTCGTAAGCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl