Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03548

HP ID(1) HP03548
Gene ID(2) 5706
Gene Symbol finder PSMC6
Protein Name proteasome (prosome, macropain) 26S subunit, ATPase, 6
RefSeq NM_002806.3
Length of RefSeq (bp) 1599
Chromosome 14q22.1
Reference DDBJ accession
UniGene Hs.156171

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe75G07 pKA1U5 GATGAGAGACGGCTTCTCATCATGGCGGACCCTCGANTATAAGGCGCTTCAGGACTACCG
ARi56G09 pGCAP10 GGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
ARiS096E22 pGCAP10 GCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGCT
ARiS109P13 pGCAP10 GGCTTCTCATCNTGGCGGACCCTANAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
RBb41F08 pGCAP1 GCTATGAGAGACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACC
RBd06D01 pGCAP10 GTTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCCCATGAAGTCCNT
RBd35F12 pGCAP10 GGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTG
RBdS075O05 pGCAP10 GGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
RBdS105O02 pGCAP10 GACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGT
RBdS156B17 pGCAP10 CNGNNNNNCGATGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl