Prev. |  KEGG KO K03064 > 

RIKEN DNA Bank Human Resource - PSMC6

Gene ID NCBI Gene 5706 |  KEGG hsa:5706
Gene Symbol PSMC6
Protein Name proteasome 26S subunit, ATPase 6
Synonyms CADP44|HEL-S-73|P44|SUG2|p42
Ortholog resources KEGG ortholog (KEGG orthology K03064) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086666 IRAL016L02 pDNR-LIB BC005390 NM_002806 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096405 M01C041A05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096453 M01C041C05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096501 M01C041E05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096549 M01C041G05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096597 M01C041I05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096645 M01C041K05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096693 M01C041M05 pDONR221 MGC10-A03 BC005390 NM_002806  
HGE096741 M01C041O05 pDONR221 MGC10-A03 BC005390 NM_002806  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006410 W01A016A10 pENTR-TOPO IRAL016L02 BC005390 NM_002806  
HGE006414 W01A016A14 pENTR-TOPO IRAL016L02 BC005390 NM_002806  
HGE006416 W01A016A16 pENTR-TOPO IRAL016L02 BC005390 NM_002806  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070151 ARe75G07 pKA1U5 NM_002806.3  
GATGAGAGACGGCTTCTCATCATGGCGGACCCTCGANTATAAGGCGCTTCAGGACTACCG
HKR182553 ARi56G09 pGCAP10 NM_002806.3  
GGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
HKR238518 ARiS096E22 pGCAP10 NM_002806.3  
GCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGCT
HKR243973 ARiS109P13 pGCAP10 NM_002806.3  
GGCTTCTCATCNTGGCGGACCCTANAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
HKR336528 RBb41F08 pGCAP1 NM_002806.3  
GCTATGAGAGACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACC
HKR362473 RBd06D01 pGCAP10 NM_002806.3  
GTTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCCCATGAAGTCCNT
HKR374132 RBd35F12 pGCAP10 NM_002806.3  
GGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTG
HKR430341 RBdS075O05 pGCAP10 NM_002806.3  
GGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGTTGC
HKR442338 RBdS105O02 pGCAP10 NM_002806.3  
GACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCGCAAGAAGT
HKR462441 RBdS156B17 pGCAP10 NM_002806.3  
CNGNNNNNCGATGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl