Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03534

HP ID(1) HP03534
Gene ID(2) 27095
Gene Symbol finder TRAPPC3
Protein Name trafficking protein particle complex 3
RefSeq NM_014408.3
Length of RefSeq (bp) 1278
Chromosome 1p34.3
Reference DDBJ accession
UniGene Hs.523131

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013F03 pGCAP10 GGCGCAGGCGCAGTGAGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGG
ARiS191M04 pGCAP10 ACGGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGC
ARiS191O10 pGCAP10 GCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGGTCGCCGAGCTAAC
RBd56D03 pGCAP10 GGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCNNNNNNTCCGGCGTCTGCAG
RBdS105B13 pGCAP10 GAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGG
RBdS187H06 pGCAP10 GGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl