Prev. |  KEGG KO K20302 > 

RIKEN DNA Bank Human Resource - TRAPPC3

Gene ID NCBI Gene 27095 |  KEGG hsa:27095
Gene Symbol TRAPPC3
Protein Name trafficking protein particle complex 3
Synonyms BET3
Ortholog resource in our bank

  TRAPPC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081953 IRAL004O17 pOTB7 BC007662 NM_014408

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004316 W01A010N04 pENTR-TOPO IRAL004O17 BC007662 NM_014408  
HGE004318 W01A010N06 pENTR-TOPO IRAL004O17 BC007662 NM_014408  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205323 ARiS013F03 pGCAP10 NM_014408.3  
GGCGCAGGCGCAGTGAGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGG
HKR276692 ARiS191M04 pGCAP10 NM_014408.3  
ACGGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGC
HKR276746 ARiS191O10 pGCAP10 NM_014408.3  
GCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGGTCGCCGAGCTAAC
HKR382475 RBd56D03 pGCAP10 NM_014408.3  
GGTCAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCNNNNNNTCCGGCGTCTGCAG
HKR442037 RBdS105B13 pGCAP10 NM_014408.3  
GAGTGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGG
HKR474974 RBdS187H06 pGCAP10 NM_014408.3  
GGCCGGTCGGTCTTGTGGGCTGAGGGGCAGCGGCTTAGGCTCCGGCGTCTGCAGGGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl