Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03522

HP ID(1) HP03522
Gene ID(2) 54107
Gene Symbol finder POLE3
Protein Name polymerase (DNA directed), epsilon 3 (p17 subunit)
RefSeq NM_017443.4
Length of RefSeq (bp) 2288
Chromosome 9q33
Reference DDBJ accession
UniGene Hs.108112

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi79D06 pGCAP10 GAGCGGCGGCAATGGCGGAGAGGCCCGAGGACCTAAACCTGCCCAATGCCGTGATCACCA
RBdS013N06 pGCAP10 GGTCAGACCGTAGCGACGCGGGAAGTCCGGACGCAGTAGCTCCCTGAAGCGGAGGCGAAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl